shRNA Lentivirus (self-inactivating), pU6-(WDR62-shRNA-Seq3)(CAT#: LV-SI2101WQ)

This product is a WDR62-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WDR62 gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and cognitive disability. The expression of WDR62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert WDR62-shRNA-Seq3
Related Target/Protein WDR62
Region CDS
TargetSeq CCATCCAAAGATAGCTTGGAT
NCBI RefSeq NM_173636
Alternative Names MCPH2; C19orf14
Titer >1*10^10 GC/mL
Related Diseases Microencephaly, cortical malformations, and cognitive disability
Target Gene
Gene ID 284403
Uniprot ID O43379

Related Products