shRNA Lentivirus (self-inactivating), pU6-(YPEL3-shRNA-Seq3)(CAT#: LV-SI0158WQ)

This product is a YPEL3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The YPEL3 gene is involved in proliferation and apoptosis in myeloid precursor cells. The expression of YPEL3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert YPEL3-shRNA-Seq3
Related Target/Protein YPEL3
Region CDS
TargetSeq GAAGTACATCATTGAACTCAA
NCBI RefSeq NM_031477
Alternative Names Ypel3; Suap
Titer >1*10^10 GC/mL
Related Diseases Mammary tumor
Target Gene
Gene ID 83719
Uniprot ID P61236

Related Products