shRNA Adeno-associated Virus Serotype 2, p7SK-(1500015O10Rik-shRNA-Seq1)(CAT#: AAV-SI3936WQ)
This product is a 1500015O10Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The products of 1500015O10Rik gene is probable hormone that may attenuate cell proliferation and induce senescence of oligodendrocyte and neural precursor cells in the central nervous system. The expression of 1500015O10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | 1500015O10Rik-shRNA-Seq1 |
Related Target/Protein | 1500015O10Rik |
Region | CDS |
TargetSeq | CCGAGAACACAGCAAAGGAAT |
NCBI RefSeq | NM_024283 |
Alternative Names | Ecrg4 |
Titer | >1*10^10 GC/mL |
Related Diseases | Nervous system disease |