shRNA Adeno-associated Virus Serotype 2, p7SK-(9330180L21Rik-shRNA-Seq1)(CAT#: AAV-SI3995WQ)

This product is a 9330180L21Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by 9330180L21Rik gene is part of various corepressor complexes mediates the recruitment of corepressor complexes to target genes, followed by chromatin compaction and repression of transcription. The expression of 9330180L21Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 9330180L21Rik-shRNA-Seq1
Related Target/Protein 9330180L21Rik
Region CDS
TargetSeq CTACCTATTGACCTGGAGTTT
NCBI RefSeq NM_175254
Alternative Names Smr; Sfmbt; AA536974; 4930442N21Rik; Sfmbt1
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 54650
Uniprot ID Q9JMD1

Related Products