shRNA Adeno-associated Virus Serotype 2, p7SK-(Adm2-shRNA-Seq3)(CAT#: AAV-SI3663WQ)

This product is a Adm2-shRNA encoding AAV, which is based on AAV-2 serotype. The Adm2 gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis. The expression of Adm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Adm2-shRNA-Seq3
Related Target/Protein Adm2
Region 3UTR
TargetSeq CCTATGAATAAGCAGGAAGAA
NCBI RefSeq NM_182928
Alternative Names AM2; dJ579N16.4
Titer >1*10^10 GC/mL
Related Diseases Gastrointestinal and cardiovascular disease
Target Gene
Gene ID 79924
Uniprot ID Q7Z4H4

Related Products