shRNA Adeno-associated Virus Serotype 2, p7SK-(Atat1-shRNA-Seq1)(CAT#: AAV-SI4026WQ)
This product is a Atat1-shRNA encoding AAV, which is based on AAV-2 serotype. The Atat1 gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. The expression of Atat1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Atat1-shRNA-Seq1 |
| Related Target/Protein | Atat1 |
| Region | CDS |
| TargetSeq | CCCACAGGTGAACAACTTTGT |
| NCBI RefSeq | NM_028476 |
| Alternative Names | TAT; MEC17; C6orf134; Nbla00487; alpha-TAT; alpha-TAT1 |
| Titer | >1*10^10 GC/mL |
