shRNA Adeno-associated Virus Serotype 2, p7SK-(AW209491-shRNA-Seq1)(CAT#: AAV-SI4028WQ)
This product is a AW209491-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of AW209491-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | AW209491-shRNA-Seq1 |
| Related Target/Protein | AW209491 |
| Region | 3UTR |
| TargetSeq | CCACTTGTCTTAGCTGGGATT |
| NCBI RefSeq | NM_134067 |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 105351 |
| Uniprot ID | A0A1Y7VLG8 |
