shRNA Adeno-associated Virus Serotype 2, p7SK-(BC049762-shRNA-Seq1)(CAT#: AAV-SI3930WQ)
This product is a BC049762-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of BC049762-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | BC049762-shRNA-Seq1 |
| Related Target/Protein | BC049762 |
| Region | CDS |
| TargetSeq | CACTTTCTGTGTACCCTCAAA |
| NCBI RefSeq | NM_177567 |
| Alternative Names | 4930503F14 |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 193286 |
| Uniprot ID | A0A338P6D5 |