shRNA Adeno-associated Virus Serotype 2, p7SK-(BEST1-shRNA-Seq1)(CAT#: AAV-SI1237WQ)
This product is a BEST1-shRNA encoding AAV, which is based on AAV-2 serotype. The BEST1 gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. The expression of BEST1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | BEST1-shRNA-Seq1 |
| Related Target/Protein | BEST1 |
| Region | CDS |
| TargetSeq | GACTCTGTATTGCGACAGCTA |
| NCBI RefSeq | NM_004183 |
| Alternative Names | ARB; BMD; BEST; RP50; VMD2; TU15B; Best1V1Delta2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Macular Dystrophy |
