shRNA Adeno-associated Virus Serotype 2, p7SK-(C030018G13Rik-shRNA-Seq1)(CAT#: AAV-SI4007WQ)
This product is a C030018G13Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by C030018G13Rik gene is component of the NALCN sodium channel complex, required for channel regulation. The expression of C030018G13Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C030018G13Rik-shRNA-Seq1 |
| Related Target/Protein | C030018G13Rik |
| Region | CDS |
| TargetSeq | GCTCTCCAATCAACAGTCAGA |
| NCBI RefSeq | NM_175510 |
| Alternative Names | UNC-80; Unc80; C230061B10Rik |
| Titer | >1*10^10 GC/mL |
