shRNA Adeno-associated Virus Serotype 2, p7SK-(C10orf27-shRNA-Seq1)(CAT#: AAV-SI1481WQ)
This product is a C10orf27-shRNA encoding AAV, which is based on AAV-2 serotype. The C10orf27 gene encodes a protein that regulates thymic epithelial cell proliferation and thymus size. It has been identified as a ligand for the class I human leukocyte antigen (HLA-I) in thymus. The expression of C10orf27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | C10orf27-shRNA-Seq1 |
Related Target/Protein | C10orf27 |
Region | CDS |
TargetSeq | GAGTACATTGGAGAAGCTCAA |
NCBI RefSeq | NM_152710 |
Alternative Names | SPATIAL; TBATA |
Titer | >1*10^10 GC/mL |
Related Diseases | Multiple sclerosis (MS) |