shRNA Adeno-associated Virus Serotype 2, p7SK-(C10orf62-shRNA-Seq1)(CAT#: AAV-SI1163WQ)

This product is a C10orf62-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C10orf62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C10orf62-shRNA-Seq1
Related Target/Protein C10orf62
Region CDS
TargetSeq CACGGTTCACATAGAGACCTT
NCBI RefSeq NM_001009997
Alternative Names bA548K23.1
Titer >1*10^10 GC/mL
Related Diseases Testis cancer
Target Gene
Gene ID 414157
Uniprot ID Q5T681

Related Products