shRNA Adeno-associated Virus Serotype 2, p7SK-(C11orf52-shRNA-Seq1)(CAT#: AAV-SI1206WQ)

This product is a C11orf52-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C11orf52-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C11orf52-shRNA-Seq1
Related Target/Protein C11orf52
Region 3UTR
TargetSeq CCACTGTTAGGTTGGAGTTAA
NCBI RefSeq NM_080659
Titer >1*10^10 GC/mL
Related Diseases DNA methylation
Target Gene
Gene ID 91894
Uniprot ID Q96A22

Related Products