shRNA Adeno-associated Virus Serotype 2, p7SK-(C11orf76-shRNA-Seq3)(CAT#: AAV-SI1228WQ)

This product is a C11orf76-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C11orf76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C11orf76-shRNA-Seq3
Related Target/Protein C11orf76
Region 3UTR
TargetSeq GCCCATCATTTGGAAAGGGAA
NCBI RefSeq NM_145308
Alternative Names SHANK2-AS3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 220070
Uniprot ID Q9BTD1

Related Products