shRNA Adeno-associated Virus Serotype 2, p7SK-(C12orf32-shRNA-Seq2)(CAT#: AAV-SI1401WQ)
This product is a C12orf32-shRNA encoding AAV, which is based on AAV-2 serotype. The C12orf32 gene plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. The expression of C12orf32-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | C12orf32-shRNA-Seq2 |
Related Target/Protein | C12orf32 |
Region | CDS |
TargetSeq | CCCGAGGACAAGTATGGAATA |
NCBI RefSeq | NM_031465 |
Alternative Names | RHINO; RHNO1; HKMT1188 |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA damage response (DDR) |