shRNA Adeno-associated Virus Serotype 2, p7SK-(C15orf45-shRNA-Seq1)(CAT#: AAV-SI1358WQ)

This product is a C15orf45-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C15orf45-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C15orf45-shRNA-Seq1
Related Target/Protein C15orf45
Region CDS
TargetSeq GCCAATTCAGCACAGATAGAA
NCBI RefSeq NM_001035530
Titer >1*10^10 GC/mL
Related Diseases Hereditary Colorectal Cancer

Related Products