shRNA Adeno-associated Virus Serotype 2, p7SK-(C20orf43-shRNA-Seq1)(CAT#: AAV-SI1361WQ)
This product is a C20orf43-shRNA encoding AAV, which is based on AAV-2 serotype. The C20orf43 gene is required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication. The expression of C20orf43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C20orf43-shRNA-Seq1 |
| Related Target/Protein | C20orf43 |
| Region | CDS |
| TargetSeq | GTTGAGAAGGTCGACAAAGAT |
| NCBI RefSeq | NM_016407 |
| Alternative Names | CDAO5; RTFDC1; HSPC164; RTF2; SHUJUN-3 |
| Titer | >1*10^10 GC/mL |
