shRNA Adeno-associated Virus Serotype 2, p7SK-(C4orf37-shRNA-Seq3)(CAT#: AAV-SI1336WQ)

This product is a C4orf37-shRNA encoding AAV, which is based on AAV-2 serotype. The C4orf37 gene may be associated with male factor infertility. The expression of C4orf37-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C4orf37-shRNA-Seq3
Related Target/Protein C4orf37
Region CDS
TargetSeq CGACAGGTAGTAATGCACCAT
NCBI RefSeq NM_174952
Alternative Names STPG2
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 285555
Uniprot ID Q8N412

Related Products