shRNA Adeno-associated Virus Serotype 2, p7SK-(C5orf13-shRNA-Seq2)(CAT#: AAV-SI1459WQ)
This product is a C5orf13-shRNA encoding AAV, which is based on AAV-2 serotype. The C5orf13 gene may have roles in neural function and cellular differentiation. The expression of C5orf13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C5orf13-shRNA-Seq2 |
| Related Target/Protein | C5orf13 |
| Region | CDS |
| TargetSeq | CAAGAACCATTTCCAAACAAG |
| NCBI RefSeq | NM_004772 |
| Alternative Names | P311; PTZ17; SEZ17; D4S114; NREP; PRO1873 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast Cancer |