shRNA Adeno-associated Virus Serotype 2, p7SK-(C8orf4-shRNA-Seq1)(CAT#: AAV-SI1063WQ)
This product is a C8orf4-shRNA encoding AAV, which is based on AAV-2 serotype. The C8orf4 gene encodes a small, monomeric, predominantly unstructured protein that functions as a positive regulator of the Wnt/beta-catenin signaling pathway. The expression of C8orf4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C8orf4-shRNA-Seq1 |
| Related Target/Protein | C8orf4 |
| Region | CDS |
| TargetSeq | GAGACAAGAAAGCAGAGGAGA |
| NCBI RefSeq | NM_020130 |
| Alternative Names | TC1; TC-1; TCIM |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Thyroid cancer, breast cancer and hematological malignancies |