shRNA Adeno-associated Virus Serotype 2, p7SK-(Fam110b-shRNA-Seq1)(CAT#: AAV-SI3913WQ)

This product is a Fam110b-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Fam110b gene may be involved in tumor progression. The expression of Fam110b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Fam110b-shRNA-Seq1
Related Target/Protein Fam110b
Region CDS
TargetSeq CAGACTTGAGTGACAGGTATT
NCBI RefSeq NM_173426
Alternative Names C8orf72
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 90362
Uniprot ID Q8TC76

Related Products