shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM129C-shRNA-Seq1)(CAT#: AAV-SI1429WQ)
This product is a FAM129C-shRNA encoding AAV, which is based on AAV-2 serotype. Based on location and expression of FAM129C gene, this would suggest it has a role in immune system function. The expression of FAM129C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | FAM129C-shRNA-Seq1 |
| Related Target/Protein | FAM129C |
| Region | CDS |
| TargetSeq | CTGAATCCTTGGGAGACCATA |
| NCBI RefSeq | NM_173544 |
| Alternative Names | BCNP1; FAM129C |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Colorectal cancer |