shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM23B-shRNA-Seq1)(CAT#: AAV-SI1356WQ)

This product is a FAM23B-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of FAM23B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM23B-shRNA-Seq1
Related Target/Protein FAM23B
Region CDS
TargetSeq CCTACCAAGGAACAAGGGCTA
NCBI RefSeq NM_001013629
Alternative Names FAM23A; TMEM236; bA16O1.2; bA162I21.2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 653567
Uniprot ID Q5W0B7

Related Products