Hot Products:
Dx Receptor PAR4 ACE BCR-exon 1/ABL-exon 2 ERalpha HPV-18 K-ras DMD-exon 8 DNMT FV-AS ICAM-1 LMNA-exon 11 Ras p53 ADC COL1A1 CagA/flaA/flaB/vacA GPR75 HBV IL-15

shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM45B-shRNA-Seq1)(CAT#: AAV-SI3893WQ)

Datasheet

This product is a FAM45B-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of FAM45B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM45B-shRNA-Seq1
Related Target/Protein FAM45B
Region 3UTR
TargetSeq CGAAGTGCTATAACTACTTTA
NCBI RefSeq NM_018472
Alternative Names HT011; DENND10P1; FAM45BP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55855
Uniprot ID Q6NSW5

Related Products

shRNA Adeno-associated Virus Serotype 2, p7SK-(FANCI-shRNA-Seq1) (CAT#:AAV-SI1340WQ) shRNA Adeno-associated Virus Serotype 2, p7SK-(Pppde1-shRNA-Seq3) (CAT#:AAV-SI3673WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(PIGW-shRNA-Seq3) (CAT#:AAV-SI0141WQ) shRNA Adeno-associated Virus Serotype 2, pU6-(Defb41-shRNA-Seq1) (CAT#:AAV-SI2208WQ) Recombinant adeno-associated virus type 9, pU6-(Domestic silkworm Akt 3'UTR), Overexpression (CAT#:AAV-GTOH1327WQ) Recombinant adeno-associated virus type 9, pU6-(Human HTR2A), Overexpression (CAT#:AAV-GTOH1059WQ) shRNA Adeno-associated Virus Serotype 2, pH1-(TRABD-shRNA-Seq1) (CAT#:AAV-SI0749WQ) shRNA Adeno-associated Virus Serotype 2, p7SK-(Zpbp-shRNA-Seq3) (CAT#:AAV-SI3658WQ)