shRNA Adeno-associated Virus Serotype 2, p7SK-(FAM53C-shRNA-Seq2)(CAT#: AAV-SI3222WQ)
This product is a FAM53C-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by FAM53C gene belongs to the FAM53 protein family. FAM53 protein family members bind to a transcriptional regulator that modulates cell proliferation. Alternative splicing results in multiple transcript variants. The expression of FAM53C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | FAM53C-shRNA-Seq2 |
| Related Target/Protein | FAM53C |
| Region | CDS |
| TargetSeq | GACTTGAATTTGATTGAGGAA |
| NCBI RefSeq | NM_016605 |
| Alternative Names | C5orf6 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Prostate cancer |
