shRNA Adeno-associated Virus Serotype 2, p7SK-(GLOD4-shRNA-Seq1)(CAT#: AAV-SI1144WQ)

This product is a GLOD4-shRNA encoding AAV, which is based on AAV-2 serotype. Transfection of GLOD4 gene in hepatocellular carcinoma cells and overexpression can inhibit the cell growth. The expression of GLOD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert GLOD4-shRNA-Seq1
Related Target/Protein GLOD4
Region 3UTR
TargetSeq CCCTCTTACTTGCTTTCACAT
NCBI RefSeq NM_016080
Alternative Names HC71; CGI-150; C17orf25
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 51031
Uniprot ID Q9HC38

Related Products