shRNA Adeno-associated Virus Serotype 2, p7SK-(Gramd1a-shRNA-Seq1)(CAT#: AAV-SI3914WQ)
This product is a Gramd1a-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gramd1a gene is cholesterol transporter that mediates non-vesicular transport of cholesterol from the plasma membrane (PM) to the endoplasmic reticulum (ER). The expression of Gramd1a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Gramd1a-shRNA-Seq1 |
| Related Target/Protein | Gramd1a |
| Region | CDS |
| TargetSeq | CGAAGATTATTTCCACCACCT |
| NCBI RefSeq | NM_027898 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |