shRNA Adeno-associated Virus Serotype 2, p7SK-(Hspa4-shRNA-Seq3)(CAT#: AAV-SI3642WQ)

This product is a Hspa4-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Hspa4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Hspa4-shRNA-Seq3
Related Target/Protein Hspa4
Region CDS
TargetSeq GACAAGTATTTGCAGTCCTAT
NCBI RefSeq NM_008300
Alternative Names RY; APG-2; HSPH2; hsp70; hsp70RY; HEL-S-5a; HS24/P52
Titer >1*10^10 GC/mL
Target Gene
Gene ID 3308
Uniprot ID P34932

Related Products