shRNA Adeno-associated Virus Serotype 2, p7SK-(KIAA1841-shRNA-Seq3)(CAT#: AAV-SI1222WQ)
This product is a KIAA1841-shRNA encoding AAV, which is based on AAV-2 serotype. KIAA1841 is targeted for the nucleus and it predicted to play a role in regulating transcription. The expression of KIAA1841-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | KIAA1841-shRNA-Seq3 |
| Related Target/Protein | KIAA1841 |
| Region | CDS |
| TargetSeq | GCAAGTTCATTGAATACTGTT |
| NCBI RefSeq | NM_032506 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung adenocarcinoma |