shRNA Adeno-associated Virus Serotype 2, p7SK-(KIAA1919-shRNA-Seq2)(CAT#: AAV-SI1174WQ)

This product is a KIAA1919-shRNA encoding AAV, which is based on AAV-2 serotype. The KIAA1919 gene may function as a sodium-dependent glucose transporter is potential channel for urea in the inner medulla of kidney. The expression of KIAA1919-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KIAA1919-shRNA-Seq2
Related Target/Protein KIAA1919
Region 3UTR
TargetSeq CTCACTGACATCTTTGAATAA
NCBI RefSeq NM_153369
Alternative Names NaGLT1; MFSD4B
Titer >1*10^10 GC/mL
Related Diseases Renal carcinoma
Target Gene
Gene ID 91749
Uniprot ID Q5TF39

Related Products