shRNA Adeno-associated Virus Serotype 2, p7SK-(KIAA1919-shRNA-Seq3)(CAT#: AAV-SI1175WQ)
This product is a KIAA1919-shRNA encoding AAV, which is based on AAV-2 serotype. The KIAA1919 gene may function as a sodium-dependent glucose transporter is potential channel for urea in the inner medulla of kidney. The expression of KIAA1919-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | KIAA1919-shRNA-Seq3 |
| Related Target/Protein | KIAA1919 |
| Region | CDS |
| TargetSeq | CCTGCACTCAACCAATCATCT |
| NCBI RefSeq | NM_153369 |
| Alternative Names | NaGLT1; MFSD4B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Renal carcinoma |