shRNA Adeno-associated Virus Serotype 2, p7SK-(Krtap26-1-shRNA-Seq1)(CAT#: AAV-SI3940WQ)
This product is a Krtap26-1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Krtap26-1 gene is essential for the formation of a rigid and resistant hair shaft. The expression of Krtap26-1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Krtap26-1-shRNA-Seq1 |
| Related Target/Protein | Krtap26-1 |
| Region | 3UTR |
| TargetSeq | GCTTCTTTCTGAGTAGCGATT |
| NCBI RefSeq | NM_027105 |
| Titer | >1*10^10 GC/mL |
