shRNA Adeno-associated Virus Serotype 2, p7SK-(LOC80154-shRNA-Seq2)(CAT#: AAV-SI1253WQ)
This product is a LOC80154-shRNA encoding AAV, which is based on AAV-2 serotype. The hypothetical protein LOC80154 were predicted to have NF-kappa B binding sites. The expression of LOC80154-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LOC80154-shRNA-Seq2 |
Related Target/Protein | LOC80154 |
Region | 3UTR |
TargetSeq | CCCATAGACTTATAAGTCTAA |
NCBI RefSeq | NM_025084 |
Titer | >1*10^10 GC/mL |
Related Diseases | Laryngeal cancer |