shRNA Adeno-associated Virus Serotype 2, p7SK-(LRRC47-shRNA-Seq2)(CAT#: AAV-SI1448WQ)
This product is a LRRC47-shRNA encoding AAV, which is based on AAV-2 serotype. The LRRC47 gene encodes a protein that significantly changed phosphorylation state in response to short-term vasopressin treatment. The expression of LRRC47-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LRRC47-shRNA-Seq2 |
| Related Target/Protein | LRRC47 |
| Region | CDS |
| TargetSeq | CCCACCAATAACCAACAGTGA |
| NCBI RefSeq | NM_020710 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Short-term vasopressin |
