shRNA Adeno-associated Virus Serotype 2, p7SK-(LSM14B-shRNA-Seq4)(CAT#: AAV-SI1424WQ)
This product is a LSM14B-shRNA encoding AAV, which is based on AAV-2 serotype. The LSM14B gene may play a role in control of mRNA translation. The expression of LSM14B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | LSM14B-shRNA-Seq4 |
| Related Target/Protein | LSM14B |
| Region | CDS |
| TargetSeq | CTTTGATTTCGAGAGTGCAAA |
| NCBI RefSeq | NM_144703 |
| Alternative Names | FT005; LSM13; FAM61B; RAP55B; C20orf40; bA11M20.3 Expression |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |