shRNA Adeno-associated Virus Serotype 2, p7SK-(MAP6D1-shRNA-Seq2)(CAT#: AAV-SI1200WQ)
This product is a MAP6D1-shRNA encoding AAV, which is based on AAV-2 serotype. The MAP6D1 gene encodes a protein highly similar to the mouse MAP6 domain containing 1 protein, which is related to the STOP proteins. The expression of MAP6D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | MAP6D1-shRNA-Seq2 |
| Related Target/Protein | MAP6D1 |
| Region | CDS |
| TargetSeq | CCTCAAGATCCACAAAGACAA |
| NCBI RefSeq | NM_024871 |
| Alternative Names | SL21; MAPO6D1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Renal cancer |