shRNA Adeno-associated Virus Serotype 2, p7SK-(Mepe-shRNA-Seq1)(CAT#: AAV-SI4004WQ)

This product is a Mepe-shRNA encoding AAV, which is based on AAV-2 serotype. The Mepe gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. The expression of Mepe-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Mepe-shRNA-Seq1
Related Target/Protein Mepe
Region CDS
TargetSeq GCTCCAGCAAAGCTGAAGTTA
NCBI RefSeq NM_053172
Alternative Names OF45
Titer >1*10^10 GC/mL
Related Diseases Aging-related trabecular bone loss
Target Gene
Gene ID 56955
Uniprot ID Q9NQ76

Related Products