shRNA Adeno-associated Virus Serotype 2, p7SK-(Mepe-shRNA-Seq1)(CAT#: AAV-SI4004WQ)
This product is a Mepe-shRNA encoding AAV, which is based on AAV-2 serotype. The Mepe gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. The expression of Mepe-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Mepe-shRNA-Seq1 |
| Related Target/Protein | Mepe |
| Region | CDS |
| TargetSeq | GCTCCAGCAAAGCTGAAGTTA |
| NCBI RefSeq | NM_053172 |
| Alternative Names | OF45 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Aging-related trabecular bone loss |