shRNA Adeno-associated Virus Serotype 2, p7SK-(Mrpl14-shRNA-Seq1)(CAT#: AAV-SI4042WQ)
This product is a Mrpl14-shRNA encoding AAV, which is based on AAV-2 serotype. The Mrpl14 gene encodes a protein component of the 39S subunit of the mitochondrial ribosome. The expression of Mrpl14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Mrpl14-shRNA-Seq1 |
Related Target/Protein | Mrpl14 |
Region | CDS |
TargetSeq | CCTCATTGAGGACAATGGCAA |
NCBI RefSeq | NM_026732 |
Alternative Names | L14mt; L32mt; MRPL32; RMPL32; RPML32; MRP-L14; MRP-L32 |
Titer | >1*10^10 GC/mL |