shRNA Adeno-associated Virus Serotype 2, p7SK-(Mrpl14-shRNA-Seq1)(CAT#: AAV-SI4042WQ)
This product is a Mrpl14-shRNA encoding AAV, which is based on AAV-2 serotype. The Mrpl14 gene encodes a protein component of the 39S subunit of the mitochondrial ribosome. The expression of Mrpl14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Mrpl14-shRNA-Seq1 |
| Related Target/Protein | Mrpl14 |
| Region | CDS |
| TargetSeq | CCTCATTGAGGACAATGGCAA |
| NCBI RefSeq | NM_026732 |
| Alternative Names | L14mt; L32mt; MRPL32; RMPL32; RPML32; MRP-L14; MRP-L32 |
| Titer | >1*10^10 GC/mL |
