shRNA Adeno-associated Virus Serotype 2, p7SK-(MRPL16-shRNA-Seq3)(CAT#: AAV-SI1219WQ)
This product is a MRPL16-shRNA encoding AAV, which is based on AAV-2 serotype. Among different species, the MRPL16 encoded proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The expression of MRPL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | MRPL16-shRNA-Seq3 |
| Related Target/Protein | MRPL16 |
| Region | 3UTR |
| TargetSeq | GAAGGATTCTGCATTTCTATT |
| NCBI RefSeq | NM_017840 |
| Alternative Names | L16mt; MRP-L16; PNAS-111 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Colorectal cancers |