shRNA Adeno-associated Virus Serotype 2, p7SK-(MTRF1L-shRNA-Seq2)(CAT#: AAV-SI1369WQ)
This product is a MTRF1L-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by MTRF1L gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. The expression of MTRF1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | MTRF1L-shRNA-Seq2 |
Related Target/Protein | MTRF1L |
Region | CDS |
TargetSeq | CGCTGCATGATCTTGAAACTT |
NCBI RefSeq | NM_019041 |
Alternative Names | MRF1L; HMRF1L; mtRF1a |
Titer | >1*10^10 GC/mL |