shRNA Adeno-associated Virus Serotype 2, p7SK-(N4bp2-shRNA-Seq1)(CAT#: AAV-SI3623WQ)
This product is a N4bp2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by N4bp2 gene binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. The expression of N4bp2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | N4bp2-shRNA-Seq1 |
| Related Target/Protein | N4bp2 |
| Region | CDS |
| TargetSeq | CTGATGACTACTTCTATATAA |
| NCBI RefSeq | NM_001024917 |
| Alternative Names | B3BP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | B-cell leukemia/lymphoma |