shRNA Adeno-associated Virus Serotype 2, p7SK-(N4bp2l2-shRNA-Seq5)(CAT#: AAV-SI3620WQ)
This product is a N4bp2l2-shRNA encoding AAV, which is based on AAV-2 serotype. The N4bp2l2 gene has enzyme binding and transcription corepressor activity. The expression of N4bp2l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | N4bp2l2-shRNA-Seq5 |
| Related Target/Protein | N4bp2l2 |
| Region | 3UTR |
| TargetSeq | GCCTCGTTACATTATATTGAA |
| NCBI RefSeq | NM_201369 |
| Alternative Names | CG005; CG016; PFAAP5; 92M18.3 |
| Titer | >1*10^10 GC/mL |