shRNA Adeno-associated Virus Serotype 2, p7SK-(NCRNA00085-shRNA-Seq2)(CAT#: AAV-SI1112WQ)
This product is a NCRNA00085-shRNA encoding AAV, which is based on AAV-2 serotype. The NCRNA00085 gene encode the sperm protein potentially involved sperm-egg fusion. The expression of NCRNA00085-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | NCRNA00085-shRNA-Seq2 |
| Related Target/Protein | NCRNA00085 |
| Region | CDS |
| TargetSeq | CAGAGGAGAAAGGCTCAAAGA |
| NCBI RefSeq | NM_207324 |
| Alternative Names | LET7EH; SPACA6P; LINC00085; SPACA6 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |