shRNA Adeno-associated Virus Serotype 2, p7SK-(NECAP1-shRNA-Seq1)(CAT#: AAV-SI1472WQ)
This product is a NECAP1-shRNA encoding AAV, which is based on AAV-2 serotype. The NECAP1 gene encodes a protein containing two characteristic WXXF motifs and the encoded protein localizes to clathrin-coated vesicles, where it binds components of the adapter protein complexes and aids in endocytosis. The expression of NECAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | NECAP1-shRNA-Seq1 |
| Related Target/Protein | NECAP1 |
| Region | CDS |
| TargetSeq | CAAGTTGTGTATCGGGAACAT |
| NCBI RefSeq | NM_015509 |
| Alternative Names | EIEE21 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Retinal Degeneration |