shRNA Adeno-associated Virus Serotype 2, p7SK-(NLRP9-shRNA-Seq1)(CAT#: AAV-SI3215WQ)
This product is a NLRP9-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by NLRP9 gene belongs to the NALP protein family. This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. The expression of NLRP9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | NLRP9-shRNA-Seq1 |
| Related Target/Protein | NLRP9 |
| Region | 3UTR |
| TargetSeq | GCTCTGGAAAGCATGGCTTTA |
| NCBI RefSeq | NM_176820 |
| Alternative Names | NOD6; NALP9; PAN12; CLR19.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Immune system disease |