shRNA Adeno-associated Virus Serotype 2, p7SK-(NSMAF-shRNA-Seq4)(CAT#: AAV-SI3412WQ)
This product is a NSMAF-shRNA encoding AAV, which is based on AAV-2 serotype. The NSMAF gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor and may play a role in regulating TNF-induced cellular responses such as inflammation. The expression of NSMAF-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | NSMAF-shRNA-Seq4 |
| Related Target/Protein | NSMAF |
| Region | CDS |
| TargetSeq | GAGTACTACTTTGAACAGCAT |
| NCBI RefSeq | NM_003580 |
| Alternative Names | FAN; GRAMD5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Inflammation |