shRNA Adeno-associated Virus Serotype 2, p7SK-(Olfr750-shRNA-Seq2)(CAT#: AAV-SI3756WQ)
This product is a Olfr750-shRNA encoding AAV, which is based on AAV-2 serotype. The Olfr750 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr750-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Olfr750-shRNA-Seq2 |
| Related Target/Protein | Olfr750 |
| Region | CDS |
| TargetSeq | GCTGCCTGTATCACTCAGTTT |
| NCBI RefSeq | NM_207558 |
| Alternative Names | MOR103-18; GA_x5J8B7W5WBF-6267395-6266441; GA_x6K02T2PMLR-6808276-6807281 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Olfactory dysfunction |