shRNA Adeno-associated Virus Serotype 2, p7SK-(PCMTD1-shRNA-Seq1)(CAT#: AAV-SI1077WQ)
This product is a PCMTD1-shRNA encoding AAV, which is based on AAV-2 serotype. PCMTD1 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-L-isoaspartate (D-aspartate) O-methyltransferase activity. The expression of PCMTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | PCMTD1-shRNA-Seq1 |
| Related Target/Protein | PCMTD1 |
| Region | CDS |
| TargetSeq | GCATTGAAACTTCAACCAGGA |
| NCBI RefSeq | NM_052937 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Glaucoma, Lung cancer |