shRNA Adeno-associated Virus Serotype 2, p7SK-(Pof1b-shRNA-Seq4)(CAT#: AAV-SI3475WQ)
This product is a Pof1b-shRNA encoding AAV, which is based on AAV-2 serotype. The Pof1b gene is expressed at trace levels in mouse prenatal ovary and is barely detectable or absent from adult ovary, in human and in the mouse respectively. The expression of Pof1b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Pof1b-shRNA-Seq4 |
Related Target/Protein | Pof1b |
Region | CDS |
TargetSeq | GAACTCTCAAAGTTGAGACAA |
NCBI RefSeq | NM_181579 |
Alternative Names | POF; POF2B |
Titer | >1*10^10 GC/mL |
Related Diseases | Premature ovarian failure |