shRNA Adeno-associated Virus Serotype 2, p7SK-(Prap1-shRNA-Seq1)(CAT#: AAV-SI3991WQ)
This product is a Prap1-shRNA encoding AAV, which is based on AAV-2 serotype. The Prap1 gene may play an important role in maintaining normal growth homeostasis in epithelial cells. The expression of Prap1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Prap1-shRNA-Seq1 |
| Related Target/Protein | Prap1 |
| Region | CDS |
| TargetSeq | GAAACAGAGAAGGTCTGGGAT |
| NCBI RefSeq | NM_009475 |
| Alternative Names | UPA; PRO1195 |
| Titer | >1*10^10 GC/mL |
